View the peptide-receptor complex
|
PDB code: 1BIV Peptide ID: 1biv_B Representation: Peptide: ball and stick Protein: cartoon Download files: receptor.pdb peptide.pdb complex.pdb binding data |
Protein style
Protein color
Pure Rainbow Peptide style Peptide color Pure Rainbow Action |
Interacting peptide residues:
| B: 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, |
Interacting receptor residues:
| A: 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, |
Peptide sequence:
| >B SGPRPRGTRGKGRRIRR |
Receptor sequence(s):
| >A GGCUCGUGUAGCUCAUUAGCUCCGAGCC |
The pepBDB database is updated monthly. Current version: 2020-03-18